ID: 1203616509

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:72211-72233
Sequence CGGCAAAAAGCCGTGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203616509_1203616519 7 Left 1203616509 Un_KI270749v1:72211-72233 CCCGCCGCCACGGCTTTTTGCCG No data
Right 1203616519 Un_KI270749v1:72241-72263 CCACGGATTTTTCCCCACCGCGG No data
1203616509_1203616513 -10 Left 1203616509 Un_KI270749v1:72211-72233 CCCGCCGCCACGGCTTTTTGCCG No data
Right 1203616513 Un_KI270749v1:72224-72246 CTTTTTGCCGCCCGCCGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203616509 Original CRISPR CGGCAAAAAGCCGTGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr