ID: 1203621660

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:133666-133688
Sequence CCTGGCACGGAGCAGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203621660_1203621671 29 Left 1203621660 Un_KI270749v1:133666-133688 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621660_1203621668 13 Left 1203621660 Un_KI270749v1:133666-133688 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203621660 Original CRISPR CCTGGCACGGAGCAGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr