ID: 1203621668

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:133702-133724
Sequence ACCTAGAGCCTGCAACACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203621659_1203621668 14 Left 1203621659 Un_KI270749v1:133665-133687 CCCGCCCAGCTGCTCCGTGCCAG No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data
1203621667_1203621668 -5 Left 1203621667 Un_KI270749v1:133684-133706 CCAGGAAGAGGAGGAGACACCTA No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data
1203621666_1203621668 0 Left 1203621666 Un_KI270749v1:133679-133701 CCGTGCCAGGAAGAGGAGGAGAC No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data
1203621662_1203621668 10 Left 1203621662 Un_KI270749v1:133669-133691 CCCAGCTGCTCCGTGCCAGGAAG No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data
1203621660_1203621668 13 Left 1203621660 Un_KI270749v1:133666-133688 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data
1203621663_1203621668 9 Left 1203621663 Un_KI270749v1:133670-133692 CCAGCTGCTCCGTGCCAGGAAGA No data
Right 1203621668 Un_KI270749v1:133702-133724 ACCTAGAGCCTGCAACACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203621668 Original CRISPR ACCTAGAGCCTGCAACACCA CGG Intergenic
No off target data available for this crispr