ID: 1203621671

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:133718-133740
Sequence ACCACGGCTCGCCTCGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203621669_1203621671 -8 Left 1203621669 Un_KI270749v1:133703-133725 CCTAGAGCCTGCAACACCACGGC No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621662_1203621671 26 Left 1203621662 Un_KI270749v1:133669-133691 CCCAGCTGCTCCGTGCCAGGAAG No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621667_1203621671 11 Left 1203621667 Un_KI270749v1:133684-133706 CCAGGAAGAGGAGGAGACACCTA No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621660_1203621671 29 Left 1203621660 Un_KI270749v1:133666-133688 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621666_1203621671 16 Left 1203621666 Un_KI270749v1:133679-133701 CCGTGCCAGGAAGAGGAGGAGAC No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621659_1203621671 30 Left 1203621659 Un_KI270749v1:133665-133687 CCCGCCCAGCTGCTCCGTGCCAG No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data
1203621663_1203621671 25 Left 1203621663 Un_KI270749v1:133670-133692 CCAGCTGCTCCGTGCCAGGAAGA No data
Right 1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203621671 Original CRISPR ACCACGGCTCGCCTCGCTGC AGG Intergenic
No off target data available for this crispr