ID: 1203622793

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138112-138134
Sequence TCCTGGCCTGACCTTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622793_1203622802 -1 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622802 Un_KI270749v1:138134-138156 AAGGGGCCAGGGCCAAGGCAGGG No data
1203622793_1203622804 9 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622804 Un_KI270749v1:138144-138166 GGCCAAGGCAGGGCCAGAGCTGG No data
1203622793_1203622806 15 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622806 Un_KI270749v1:138150-138172 GGCAGGGCCAGAGCTGGACTTGG No data
1203622793_1203622807 18 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622807 Un_KI270749v1:138153-138175 AGGGCCAGAGCTGGACTTGGAGG No data
1203622793_1203622809 26 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data
1203622793_1203622800 -6 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622800 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
1203622793_1203622801 -2 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622801 Un_KI270749v1:138133-138155 GAAGGGGCCAGGGCCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622793 Original CRISPR TCCTGGCCTGACCTTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr