ID: 1203622799

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138129-138151
Sequence CCTTGGCCCTGGCCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622799_1203622807 1 Left 1203622799 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1203622807 Un_KI270749v1:138153-138175 AGGGCCAGAGCTGGACTTGGAGG No data
1203622799_1203622804 -8 Left 1203622799 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1203622804 Un_KI270749v1:138144-138166 GGCCAAGGCAGGGCCAGAGCTGG No data
1203622799_1203622806 -2 Left 1203622799 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1203622806 Un_KI270749v1:138150-138172 GGCAGGGCCAGAGCTGGACTTGG No data
1203622799_1203622809 9 Left 1203622799 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622799 Original CRISPR CCTTGGCCCTGGCCCCTTCC TGG (reversed) Intergenic
No off target data available for this crispr