ID: 1203622803

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138140-138162
Sequence CTCTGGCCCTGCCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622803_1203622807 -10 Left 1203622803 Un_KI270749v1:138140-138162 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1203622807 Un_KI270749v1:138153-138175 AGGGCCAGAGCTGGACTTGGAGG No data
1203622803_1203622811 24 Left 1203622803 Un_KI270749v1:138140-138162 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1203622811 Un_KI270749v1:138187-138209 GATTTGCCCTGCCCCGACGTTGG No data
1203622803_1203622809 -2 Left 1203622803 Un_KI270749v1:138140-138162 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622803 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG (reversed) Intergenic