ID: 1203622807

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138153-138175
Sequence AGGGCCAGAGCTGGACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622793_1203622807 18 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622807 Un_KI270749v1:138153-138175 AGGGCCAGAGCTGGACTTGGAGG No data
1203622799_1203622807 1 Left 1203622799 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1203622807 Un_KI270749v1:138153-138175 AGGGCCAGAGCTGGACTTGGAGG No data
1203622803_1203622807 -10 Left 1203622803 Un_KI270749v1:138140-138162 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1203622807 Un_KI270749v1:138153-138175 AGGGCCAGAGCTGGACTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622807 Original CRISPR AGGGCCAGAGCTGGACTTGG AGG Intergenic
No off target data available for this crispr