ID: 1203622808

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138157-138179
Sequence GACACCTCCAAGTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622808_1203622811 7 Left 1203622808 Un_KI270749v1:138157-138179 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1203622811 Un_KI270749v1:138187-138209 GATTTGCCCTGCCCCGACGTTGG No data
1203622808_1203622817 23 Left 1203622808 Un_KI270749v1:138157-138179 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1203622817 Un_KI270749v1:138203-138225 ACGTTGGCCCAGCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622808 Original CRISPR GACACCTCCAAGTCCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr