ID: 1203622809

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138161-138183
Sequence AGCTGGACTTGGAGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622803_1203622809 -2 Left 1203622803 Un_KI270749v1:138140-138162 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data
1203622805_1203622809 -8 Left 1203622805 Un_KI270749v1:138146-138168 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data
1203622793_1203622809 26 Left 1203622793 Un_KI270749v1:138112-138134 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data
1203622799_1203622809 9 Left 1203622799 Un_KI270749v1:138129-138151 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1203622809 Un_KI270749v1:138161-138183 AGCTGGACTTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622809 Original CRISPR AGCTGGACTTGGAGGTGTCC TGG Intergenic
No off target data available for this crispr