ID: 1203622811

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:138187-138209
Sequence GATTTGCCCTGCCCCGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203622805_1203622811 18 Left 1203622805 Un_KI270749v1:138146-138168 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 1203622811 Un_KI270749v1:138187-138209 GATTTGCCCTGCCCCGACGTTGG No data
1203622803_1203622811 24 Left 1203622803 Un_KI270749v1:138140-138162 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1203622811 Un_KI270749v1:138187-138209 GATTTGCCCTGCCCCGACGTTGG No data
1203622808_1203622811 7 Left 1203622808 Un_KI270749v1:138157-138179 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1203622811 Un_KI270749v1:138187-138209 GATTTGCCCTGCCCCGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203622811 Original CRISPR GATTTGCCCTGCCCCGACGT TGG Intergenic
No off target data available for this crispr