ID: 1203626136

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:25127-25149
Sequence TAGAAGGGCTGGAGGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203626136_1203626142 2 Left 1203626136 Un_KI270750v1:25127-25149 CCTAATTCCCTCCAGCCCTTCTA No data
Right 1203626142 Un_KI270750v1:25152-25174 ACACACTCATACCATCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203626136 Original CRISPR TAGAAGGGCTGGAGGGAATT AGG (reversed) Intergenic
No off target data available for this crispr