ID: 1203626979

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:33960-33982
Sequence CAGTATAGCCCCAGATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203626979_1203626992 6 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626992 Un_KI270750v1:33989-34011 GTGGCAGGGGTGGTGGGGGGAGG No data
1203626979_1203626989 1 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626989 Un_KI270750v1:33984-34006 CTGTGGTGGCAGGGGTGGTGGGG No data
1203626979_1203626985 -4 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626985 Un_KI270750v1:33979-34001 ACTGCCTGTGGTGGCAGGGGTGG No data
1203626979_1203626986 -1 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626986 Un_KI270750v1:33982-34004 GCCTGTGGTGGCAGGGGTGGTGG No data
1203626979_1203626984 -7 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626984 Un_KI270750v1:33976-33998 TATACTGCCTGTGGTGGCAGGGG No data
1203626979_1203626990 2 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626990 Un_KI270750v1:33985-34007 TGTGGTGGCAGGGGTGGTGGGGG No data
1203626979_1203626991 3 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626991 Un_KI270750v1:33986-34008 GTGGTGGCAGGGGTGGTGGGGGG No data
1203626979_1203626988 0 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626988 Un_KI270750v1:33983-34005 CCTGTGGTGGCAGGGGTGGTGGG No data
1203626979_1203626983 -8 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626983 Un_KI270750v1:33975-33997 CTATACTGCCTGTGGTGGCAGGG No data
1203626979_1203626982 -9 Left 1203626979 Un_KI270750v1:33960-33982 CCTGGCTATCTGGGGCTATACTG No data
Right 1203626982 Un_KI270750v1:33974-33996 GCTATACTGCCTGTGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203626979 Original CRISPR CAGTATAGCCCCAGATAGCC AGG (reversed) Intergenic
No off target data available for this crispr