ID: 1203627021

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:34121-34143
Sequence CTACAATGCTGGCGGGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203627009_1203627021 14 Left 1203627009 Un_KI270750v1:34084-34106 CCGCAGCAGGGAGTGGGTTGGGT No data
Right 1203627021 Un_KI270750v1:34121-34143 CTACAATGCTGGCGGGGGGGTGG No data
1203627007_1203627021 15 Left 1203627007 Un_KI270750v1:34083-34105 CCCGCAGCAGGGAGTGGGTTGGG No data
Right 1203627021 Un_KI270750v1:34121-34143 CTACAATGCTGGCGGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203627021 Original CRISPR CTACAATGCTGGCGGGGGGG TGG Intergenic
No off target data available for this crispr