ID: 1203631183

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:73855-73877
Sequence CAGAGCAGACAGAAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203631183_1203631186 0 Left 1203631183 Un_KI270750v1:73855-73877 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1203631186 Un_KI270750v1:73878-73900 CATCCTTCACCTTCTACATCAGG 0: 6
1: 1
2: 3
3: 24
4: 191
1203631183_1203631189 16 Left 1203631183 Un_KI270750v1:73855-73877 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1203631189 Un_KI270750v1:73894-73916 CATCAGGAAGCTCAAGTCACCGG No data
1203631183_1203631192 28 Left 1203631183 Un_KI270750v1:73855-73877 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1203631192 Un_KI270750v1:73906-73928 CAAGTCACCGGGCTGAGCCTGGG No data
1203631183_1203631190 17 Left 1203631183 Un_KI270750v1:73855-73877 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1203631190 Un_KI270750v1:73895-73917 ATCAGGAAGCTCAAGTCACCGGG No data
1203631183_1203631191 27 Left 1203631183 Un_KI270750v1:73855-73877 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1203631191 Un_KI270750v1:73905-73927 TCAAGTCACCGGGCTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203631183 Original CRISPR CAGAGCAGACAGAAGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr