ID: 1203631741

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:77373-77395
Sequence CAGGCTGCACACCTGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203631741_1203631749 18 Left 1203631741 Un_KI270750v1:77373-77395 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1203631749 Un_KI270750v1:77414-77436 ATAGAGCCTAGGTGTACAGTAGG No data
1203631741_1203631747 7 Left 1203631741 Un_KI270750v1:77373-77395 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1203631747 Un_KI270750v1:77403-77425 TAGGCTGTGCCATAGAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203631741 Original CRISPR CAGGCTGCACACCTGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr