ID: 1203634250

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:96300-96322
Sequence CCGTGGGAACCACTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203634243_1203634250 7 Left 1203634243 Un_KI270750v1:96270-96292 CCAAGCCTCGGGGACTGGTTTCT 0: 21
1: 58
2: 24
3: 18
4: 133
Right 1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG No data
1203634244_1203634250 2 Left 1203634244 Un_KI270750v1:96275-96297 CCTCGGGGACTGGTTTCTAAGAC 0: 29
1: 60
2: 30
3: 13
4: 74
Right 1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG No data
1203634238_1203634250 28 Left 1203634238 Un_KI270750v1:96249-96271 CCACGGAGGGCTTCTGCTTTGCC No data
Right 1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203634250 Original CRISPR CCGTGGGAACCACTGTGATG GGG Intergenic
No off target data available for this crispr