ID: 1203635517

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:106856-106878
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 13, 1: 55, 2: 78, 3: 80, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203635517_1203635520 7 Left 1203635517 Un_KI270750v1:106856-106878 CCCATATCATTATCAGCATTTTG 0: 13
1: 55
2: 78
3: 80
4: 363
Right 1203635520 Un_KI270750v1:106886-106908 CCATTTAAAAAGTCTCTACTAGG No data
1203635517_1203635521 8 Left 1203635517 Un_KI270750v1:106856-106878 CCCATATCATTATCAGCATTTTG 0: 13
1: 55
2: 78
3: 80
4: 363
Right 1203635521 Un_KI270750v1:106887-106909 CATTTAAAAAGTCTCTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203635517 Original CRISPR CAAAATGCTGATAATGATAT GGG (reversed) Intergenic
901479950 1:9518397-9518419 CAAAATGCTTCTAATGTTCTGGG + Intergenic
903748861 1:25606653-25606675 GAAAATGAGGATAATGATACTGG - Intergenic
904928641 1:34068464-34068486 CAACATGCTAATAATAACATGGG - Intronic
905113487 1:35616375-35616397 CAAAATCCTTAAAATGTTATTGG - Intronic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
906883292 1:49616736-49616758 GAAATTGCTGCTAATGAAATAGG - Intronic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909020135 1:70421952-70421974 CAAAATGGAGATAATTATACCGG + Intronic
909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909156437 1:72083672-72083694 CAAAATAATGCTAATGAAATGGG - Intronic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909480779 1:76127286-76127308 TAAAATGCTACTAATGATTTGGG - Intronic
909525130 1:76614019-76614041 CAAAATGCTTAAAATGTTTTGGG + Intronic
909535377 1:76729916-76729938 CAAAATTTTGAGAAAGATATTGG + Intergenic
909701406 1:78528108-78528130 CAAAAGGCTGAAAATTACATGGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909998593 1:82313505-82313527 CAAAGTGCTGATAAACTTATGGG - Intergenic
910357950 1:86381903-86381925 CAAAATGTTAACAATGATTTTGG + Intronic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
910874354 1:91864324-91864346 CAAATTGCTGACAAGAATATTGG + Intronic
910941297 1:92537838-92537860 CATAATGCTGAAAATGTTTTTGG + Intronic
911064776 1:93778480-93778502 CAGATTGCTGGTAATAATATTGG - Intronic
911364679 1:96922724-96922746 TAAAATCCTGAAAATCATATAGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911444082 1:97969317-97969339 CAAAATTGTGAAAATGAAATTGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912389727 1:109294516-109294538 CAAAATGCTTATAATTTAATAGG + Intronic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917973720 1:180225296-180225318 CAAAATGCAAATAATGAAAGGGG + Intergenic
918130623 1:181625016-181625038 CAAAATACTGATAATGCACTTGG - Intronic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920424387 1:205862395-205862417 CAAAGGGCGGATAATTATATGGG + Intergenic
920723570 1:208412741-208412763 AAAAATGATGATGATGATAGTGG - Intergenic
920770837 1:208883509-208883531 CCATATCCTGATAATGAGATGGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921553715 1:216570571-216570593 CAAAATTCTTATAATGAAAGAGG - Intronic
921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
923509609 1:234638984-234639006 CAAAATGCAGATAAAGGAATTGG - Intergenic
1063110239 10:3029294-3029316 CAAAATGTTGAAAATGTTACTGG + Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065608759 10:27449052-27449074 TAAAATGCATATAATGTTATGGG + Intergenic
1066211675 10:33246097-33246119 CAAAATGGTCAAAATCATATTGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068108873 10:52654658-52654680 CAAATTGCTTGTAATGTTATTGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1070255486 10:74810093-74810115 CAAAATGTTGATAATGTTTGCGG + Intergenic
1070951453 10:80434664-80434686 CAAAAAGCTGGTAAGGAGATTGG + Exonic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1071358323 10:84820034-84820056 TGAACTGCTTATAATGATATGGG - Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073152200 10:101319735-101319757 CAAAATGCTGATAAGCCTGTGGG + Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1074083467 10:110186716-110186738 TCAAATGCTGATAAGGATGTGGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078885811 11:15498708-15498730 ATAAAAGCTGATAATAATATTGG - Intergenic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079850304 11:25525003-25525025 CTAAATTCAAATAATGATATTGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080729275 11:34932234-34932256 CAAAATCCAGATTATAATATGGG + Intronic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1085552517 11:77387685-77387707 CAAAAGCCTACTAATGATATAGG + Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086802826 11:91198516-91198538 TTCAATGTTGATAATGATATAGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087387917 11:97496381-97496403 CTAAGTGCTAATAATGATCTTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087938426 11:104063217-104063239 CTTAATGTTGATGATGATATTGG - Intronic
1088119260 11:106348995-106349017 GAAAAGGCAGATAATGAGATTGG + Intergenic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1088604813 11:111518504-111518526 CCAAATGGTGATAATCATAATGG - Intronic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094785221 12:33840964-33840986 CCTAATTCTGATAATGTTATTGG + Intergenic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095520348 12:43056408-43056430 CAAGATGCATAAAATGATATGGG + Intergenic
1095651210 12:44611690-44611712 GAAAATGGTTACAATGATATTGG - Intronic
1096928381 12:55174409-55174431 CAAAATACTGGTGAGGATATAGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097841068 12:64321815-64321837 CAAACTGCTGAAAATAATAAAGG - Intronic
1098110472 12:67116559-67116581 AAAAATTCAGATAATGAAATAGG - Intergenic
1098408323 12:70151242-70151264 CCAAGTGCTCATAATCATATTGG + Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1098896949 12:76073940-76073962 GAAAATGCTGAGCATGATAATGG - Intronic
1099248723 12:80225591-80225613 CAAAATGTTGAGAAGGAAATAGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099582586 12:84469949-84469971 CAAAATGTTGCTAAAGATTTGGG - Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100703583 12:97176464-97176486 TAAACTGCTGATAATGTTTTTGG - Intergenic
1100733547 12:97500662-97500684 CAAAATGCATATCATAATATCGG - Intergenic
1100778885 12:98002776-98002798 TAAAATGCTGTTACTGACATTGG - Intergenic
1101137893 12:101764305-101764327 GAAAATGCTGAAAATCACATAGG - Exonic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1107806688 13:44159936-44159958 TAAAATGCAGATGATGATGTTGG - Intronic
1108236171 13:48408170-48408192 CAAAATGCTGAAAAGTAAATTGG - Intronic
1108977018 13:56458705-56458727 CTCAATGATGATAATGATAATGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109421616 13:62119738-62119760 CGAAATGCTGAAAAGAATATCGG + Intergenic
1109451463 13:62520066-62520088 CAAAATGCTGAGAAAGAAAATGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110381398 13:74855685-74855707 GACAATGGTGATAATGATAATGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111459346 13:88519394-88519416 CAAGTTGCTGATAATGACACGGG + Intergenic
1111496982 13:89063612-89063634 GGATATGCTGATAATGAAATGGG - Intergenic
1111647158 13:91045983-91046005 GAAAATGTTAATAATTATATTGG - Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113233538 13:108242135-108242157 CAAAATGCTGCTGATGATCGAGG - Intergenic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115042987 14:28954801-28954823 CATAATACTTATAATGATAATGG + Intergenic
1115533355 14:34346783-34346805 CAAAATGATGGTAATGAGAGTGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116196141 14:41728067-41728089 GAAAATTCTGGTAATGATTTTGG + Intronic
1116377942 14:44227641-44227663 CTAAATGCATATAATGATTTGGG + Intergenic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1117369969 14:55068735-55068757 CAAAATACTGATTATTTTATTGG - Exonic
1117783892 14:59262573-59262595 GAAAATGTTGAAAATGCTATAGG - Intronic
1118118803 14:62812366-62812388 CAATATGTTGATAAAGACATAGG + Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124144310 15:27108938-27108960 GAAAATGCTCATAATAAAATAGG + Intronic
1124144313 15:27109015-27109037 ACAAATGCTCATAATAATATAGG - Intronic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127000912 15:54503652-54503674 AGAAATGCTGATAATGAGTTTGG - Intronic
1127420588 15:58801404-58801426 AAAAAAGATGATAATTATATAGG + Intronic
1127664365 15:61130816-61130838 CAAAATGTTCATAATAAAATGGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137758589 16:50922149-50922171 CCACATGCTGAAAATGACATTGG - Intergenic
1137767367 16:50988257-50988279 CAAAATGGTGATCAAGATACAGG - Intergenic
1138052837 16:53799431-53799453 CAAAATGGTGATCAAGACATAGG - Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140920015 16:79528766-79528788 CAAAACCCTGAAAATGAAATTGG + Intergenic
1142824585 17:2500763-2500785 CAAAATTATGATAACTATATGGG - Intronic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143862946 17:9904635-9904657 CGAGATGCTGATATTGATAGAGG - Intronic
1144141862 17:12357148-12357170 GAAAATGGTGAGAATAATATTGG + Intergenic
1145047652 17:19630835-19630857 CAAAATGGTAAAAATGCTATTGG + Intergenic
1147898782 17:43769965-43769987 CAAAGTGCTGGTGAAGATATGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149040492 17:52182467-52182489 CATAAAGATGATGATGATATTGG - Intergenic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1150206379 17:63411831-63411853 CAAAATGCTGTTAAAGATCAAGG + Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153176870 18:2385054-2385076 CAAAATATAGATAATTATATGGG + Intergenic
1155244189 18:23891619-23891641 CAAAATGATGTTAAGGATAAGGG + Intronic
1155947023 18:31865489-31865511 TAAAATGCTAATAAGGATTTGGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156274330 18:35568498-35568520 CAAAATGAGGAAATTGATATTGG - Intergenic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1158693307 18:59680981-59681003 CAAAAACCTGATAATTATCTGGG + Intronic
1159540724 18:69771902-69771924 CAAAATGATGACAAAGATAAAGG + Intronic
1159625071 18:70683355-70683377 CAAAGTACAGATAACGATATGGG + Intergenic
1164059303 19:21654075-21654097 CAAAATTCTGAAAAGTATATTGG - Intergenic
1164067337 19:21729300-21729322 CAAAATTCTGAAAAGTATATTGG + Intronic
1165504370 19:36215504-36215526 GAAAGTGCTGATAATTATAACGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166027027 19:40095935-40095957 CAAAATCAGGAAAATGATATAGG + Intergenic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925323204 2:2993028-2993050 GAGAAAGCTAATAATGATATAGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926255102 2:11186923-11186945 TAAAATGCTGTTTATAATATAGG - Intronic
926998033 2:18759407-18759429 CAAAATTATGATAACTATATTGG - Intergenic
927114157 2:19885352-19885374 TAAAATCCTGATAATGAACTGGG - Intergenic
927409363 2:22806848-22806870 AAAAATGCTGACAATTACATGGG - Intergenic
928044138 2:27910524-27910546 CAAGGTGCTGATAATGTTCTGGG - Intronic
928349993 2:30541861-30541883 CCTAATGCTGACAAGGATATGGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929686778 2:44041969-44041991 CCAAATGTTGATAATGATTGAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931045656 2:58349754-58349776 CAAAATGTTGATAATGTTGGGGG - Intergenic
931510035 2:62981536-62981558 AAAAATCCTATTAATGATATGGG + Intronic
931621534 2:64215539-64215561 CAAAATGCAGAGACTGCTATTGG + Intergenic
931630796 2:64296756-64296778 CACATTGCTGATAATGAAAGAGG - Intergenic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933121027 2:78538526-78538548 CCAAATGCTGATGAAGATGTAGG + Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935733406 2:106085236-106085258 CAGAATTCTGATAATGGAATGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938768259 2:134478391-134478413 CATAATGCTCATAAAAATATGGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
940234808 2:151498710-151498732 GAAAATGCTGTTAATCACATAGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940594309 2:155770127-155770149 CAAAATGATGGTGATGATGTTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941650911 2:168091755-168091777 CAAAATGTTGATAATGTTGAAGG - Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943392728 2:187289890-187289912 CCAAATGGTAAAAATGATATGGG - Intergenic
943668954 2:190640104-190640126 AGAAATGCTCATAATGTTATGGG - Intergenic
943808085 2:192148967-192148989 AAAAATGCTGAAAATGCTGTGGG - Intronic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
944641552 2:201731445-201731467 TAAAAGGCTGATGATGAAATCGG + Intronic
944756233 2:202764720-202764742 CAAATTGTTGAAAAAGATATTGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945799418 2:214408092-214408114 TAAAATACAGAAAATGATATTGG - Intronic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171358738 20:24571320-24571342 CAAAATCCAGAAAATGACATTGG - Intronic
1173240808 20:41295384-41295406 AAAAATGCTTACAATGACATGGG + Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174736100 20:52967628-52967650 TAAAATTCTGAGAAGGATATTGG + Intergenic
1175526452 20:59637944-59637966 CAAAATGGGGATAATAATAATGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177340492 21:19793421-19793443 CAAAATAATGATAAATATATTGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177957086 21:27611704-27611726 CATAGTGCTGATAATGGTAATGG - Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178169900 21:30028656-30028678 AGAAATGCTGATAATCAAATTGG + Intergenic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
949506440 3:4732535-4732557 CAAAAACCTCATAATGCTATAGG - Intronic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
952973928 3:38677977-38677999 AAAATTTCTGATAATGACATGGG + Intergenic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958551524 3:95620010-95620032 CAAAATGGTGATTCTGAAATTGG + Intergenic
958680538 3:97325137-97325159 TAAAATGGGGATAATAATATAGG + Intronic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959275931 3:104277653-104277675 CAAAATGATAATAATGAACTTGG - Intergenic
959526566 3:107383949-107383971 ATAAATGGTGATAATGATACTGG + Intergenic
961937061 3:130595980-130596002 CCAAGTGCTGATAAGGATGTGGG + Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963181472 3:142361581-142361603 CCAAGTGTTGACAATGATATAGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963951242 3:151204381-151204403 AAAGATGCTTATGATGATATTGG + Intronic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965736015 3:171822038-171822060 CCAAATGCTGAGCATGATTTTGG + Intergenic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967678607 3:192331857-192331879 CCAAATGCTGAGAAAAATATTGG + Intronic
967864958 3:194182399-194182421 GGAAATGATGATGATGATATTGG + Intergenic
968195054 3:196699577-196699599 CAAAATGCTTACTATGGTATTGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971079610 4:23195159-23195181 CAATATGCTAATAATGGGATGGG - Intergenic
971181207 4:24330018-24330040 CATGATGATGATAATGATAAGGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974185089 4:58435211-58435233 AGAGATGCTGATACTGATATTGG - Intergenic
974625859 4:64428543-64428565 CAAAATGCTAATCATAATACAGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974702562 4:65470919-65470941 CAAAATTCAGATATTGTTATAGG - Intronic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975507262 4:75151299-75151321 AAAAATGCTGGTGAGGATATAGG - Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977424181 4:96845339-96845361 TAAAAGGCAGATGATGATATTGG - Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
978659367 4:111105679-111105701 CACAATGGTGTTAATCATATAGG - Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979451678 4:120878886-120878908 CCAAATGCTGACAAGGACATGGG + Intronic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981111849 4:140943888-140943910 CTAATTGGTGATAATGCTATAGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982762231 4:159299075-159299097 CAAAACCCTGACAATGATATGGG + Intronic
982894378 4:160899316-160899338 CCAAATGTTGATACTGGTATTGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984387162 4:179075844-179075866 TAAAATACTAATAAAGATATTGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984870403 4:184319883-184319905 CAAAATGTTGCCAATGTTATGGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986382630 5:7202108-7202130 AAAAATGTTCAGAATGATATTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987615805 5:20273019-20273041 CTATATGCTGATAATCATTTAGG + Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988095877 5:26609463-26609485 GATGATGATGATAATGATATCGG + Intergenic
988235829 5:28542786-28542808 GAACAAGTTGATAATGATATAGG - Intergenic
988319612 5:29676665-29676687 CCACATGCAAATAATGATATTGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
988995522 5:36711358-36711380 GAAAATGCTGCTATTGAAATGGG - Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989711163 5:44399138-44399160 AAAAATGATGAAAATGAAATTGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990253208 5:53938451-53938473 CAAAATACTGAAAAGGTTATTGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990919716 5:60948930-60948952 CCAAGTGTTGATAAGGATATAGG - Intronic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991989464 5:72323231-72323253 CAAAATATTGATAATGATTGAGG + Intronic
992410170 5:76497694-76497716 AACAATGCTGAGAATTATATGGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993082660 5:83320749-83320771 AAAAATGCTAATAATCATCTGGG - Intronic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993913822 5:93717282-93717304 GAAAATGCTGAGAATGAGGTAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996347989 5:122508290-122508312 TAAAATGGAGATAATGATAATGG - Intergenic
996809336 5:127497419-127497441 CCAAATGCTGACAAGGATGTGGG + Intergenic
998686592 5:144534128-144534150 CAATATCATGAAAATGATATTGG + Intergenic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1000905006 5:166954941-166954963 TAAGATGCTAAAAATGATATGGG - Intergenic
1001874848 5:175191024-175191046 TAAAATGCACATAATCATATGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004039267 6:11959807-11959829 CAAGATACTAATGATGATATAGG + Intergenic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004451405 6:15751148-15751170 CAAAATGTTGAAAATGACAAAGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1009215653 6:60917023-60917045 CAAAATGGGTATAATAATATTGG - Intergenic
1009232190 6:61076470-61076492 CAACATGCTGTTAAAGAAATGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010082537 6:71880986-71881008 CTAGATGCTGACAATGAAATTGG - Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010226484 6:73494251-73494273 GAAAATACTGAGAATAATATTGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1012056505 6:94418906-94418928 CAAAATAATGATAAATATATGGG - Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012184650 6:96197726-96197748 CAACATCCTGCTAATGATGTTGG + Intronic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012652068 6:101767357-101767379 CAAAATGTTTATAATGGTAATGG - Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014960510 6:127678200-127678222 AAAAAGACCGATAATGATATTGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015426392 6:133073723-133073745 CAAAATCCTCATCATGAAATAGG - Intergenic
1015915487 6:138212025-138212047 CAAAATGCTTAAAAAGATAAGGG + Intronic
1016418637 6:143860435-143860457 CAATATGATGATGATGAAATTGG + Exonic
1016427417 6:143949269-143949291 CAGAAGGATGATAATGATTTGGG - Intronic
1016842962 6:148543078-148543100 CAAAATACTGATAAAGTTTTAGG - Intronic
1016851365 6:148622545-148622567 TAAAATGCTGATCATGACCTGGG + Intergenic
1018965248 6:168480400-168480422 GAAAATGTTAATAAAGATATAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019804184 7:3110795-3110817 CCAAATGCTGACAAAGATGTGGG + Intergenic
1020692730 7:11377379-11377401 CAAGATGTTATTAATGATATTGG + Intronic
1020725555 7:11809208-11809230 CAAATTACTGGTAATGATTTTGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021020370 7:15590863-15590885 CAAAATTCTGACAATGTTTTTGG + Intergenic
1022560009 7:31337762-31337784 CACTAAGCTGACAATGATATTGG - Exonic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG + Intergenic
1023417290 7:39945440-39945462 TATAATGCTGATGACGATATAGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026467405 7:70666207-70666229 CAAAATGGGAATAATGATAATGG + Intronic
1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG + Intronic
1027337269 7:77165033-77165055 AAAAGAGCTGATGATGATATTGG + Intronic
1027337444 7:77167893-77167915 AAGAATTTTGATAATGATATTGG - Intronic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1028661048 7:93275502-93275524 AAAAATGCTAATAATCATCTGGG - Intronic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1029778298 7:102702905-102702927 AAGAATTTTGATAATGATATTGG + Intergenic
1029778529 7:102706087-102706109 AAAAGAGCTGATGATGATATTGG - Intergenic
1031212055 7:118841701-118841723 CAACATGCAGAGAATGAAATTGG - Intergenic
1031217340 7:118911989-118912011 ACAAATGCTGACAAAGATATGGG + Intergenic
1031226421 7:119043281-119043303 AAAAATCATGATAATTATATTGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031331237 7:120467189-120467211 CAATATGATGAGAATAATATAGG + Intronic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033475986 7:141693348-141693370 CCAAATGCTGATGAGGATGTGGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1038384053 8:27124150-27124172 CAGAATGCTTTTAATGAGATGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039652306 8:39354791-39354813 CAAAATGCTGATGAGGCTGTGGG + Intergenic
1039864891 8:41491582-41491604 CAAAATGGTCATCAGGATATAGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040692161 8:49952316-49952338 CAAAATCCTGATGAGAATATGGG + Intronic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1041876888 8:62698801-62698823 GAAAATGCTGAAAAAGATAATGG + Intronic
1042756333 8:72216650-72216672 AAATTTGCTGATAATCATATTGG - Intergenic
1043002564 8:74777625-74777647 CAAAATAATATTAATGATATTGG + Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044419122 8:91971210-91971232 AAAAATTATAATAATGATATAGG - Intronic
1044759388 8:95501821-95501843 CAAAGAACTGATAATAATATAGG - Intergenic
1044906277 8:97007152-97007174 CAGAATGCTGTTAAAGATGTCGG - Intronic
1044928952 8:97233672-97233694 CCAAATACTAATAATGATAATGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046151855 8:110237727-110237749 CTAAATGCTGGTAAGGATGTGGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046760371 8:118014190-118014212 CAAAATGGGGTTAAAGATATTGG + Intronic
1046978493 8:120310894-120310916 CAACATGGTGAAAATGAGATGGG - Intronic
1047915867 8:129583202-129583224 CAGACAGCTGTTAATGATATCGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051558956 9:18418605-18418627 TAAAATGGGGAAAATGATATAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051707581 9:19896695-19896717 CATAATGCTGTGAAGGATATTGG - Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052264847 9:26560319-26560341 CAAAAAGCTGATTATAAGATAGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052530356 9:29675251-29675273 CAAAGTGCTGACAAAGATTTTGG + Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1052980374 9:34444044-34444066 CCAAGTGGGGATAATGATATGGG - Intronic
1053311163 9:37021037-37021059 GAAAATGCTAATAATAGTATGGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1057011172 9:91602809-91602831 CCAAATGCTGGTGAGGATATGGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059847810 9:118300970-118300992 CCAAATTCTGATACTGATACTGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060033570 9:120235864-120235886 CAACATGATGATAATGATGGTGG - Intergenic
1060244909 9:121936990-121937012 CAAAATGCAGACAAGGATTTTGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186060782 X:5703927-5703949 CAAAAAGCTCACAATTATATGGG + Intergenic
1188051131 X:25487960-25487982 CAAGATGATGATGATGATAACGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190822894 X:53990886-53990908 GAAGATGGTGATAATGATGTGGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191161281 X:57331770-57331792 CAATATGCTGTAAATCATATGGG - Exonic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192207195 X:69104352-69104374 TAAAATGGTGATGATGATAATGG + Intergenic
1192223052 X:69210413-69210435 CAAAATGGGGATGATAATATTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193232355 X:79062706-79062728 CACACTGCTGATAAAGACATTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1195509524 X:105698173-105698195 AATAATGATGATAATGATAGTGG - Intronic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196327125 X:114419804-114419826 CCAAATGCTGACTAAGATATGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198626809 X:138584722-138584744 CAAAATGCTAATAATGCAAGCGG - Intergenic
1198733507 X:139760300-139760322 GAAAATGATGATAATGATGATGG - Intronic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199370666 X:147043734-147043756 CCTAATGTTGTTAATGATATAGG - Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199518579 X:148707831-148707853 CAAAATTCTAATGATGACATTGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic