ID: 1203638347

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:135460-135482
Sequence CCCTCTATGCTGGATCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203638344_1203638347 -6 Left 1203638344 Un_KI270750v1:135443-135465 CCTGTGCTGAGGCAGCTCCCTCT No data
Right 1203638347 Un_KI270750v1:135460-135482 CCCTCTATGCTGGATCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203638347 Original CRISPR CCCTCTATGCTGGATCTGCG AGG Intergenic
No off target data available for this crispr