ID: 1203639104

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:141754-141776
Sequence CTAACATTTTTGCAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203639104_1203639106 -4 Left 1203639104 Un_KI270750v1:141754-141776 CCAGCAGCCTGCAAAAATGTTAG No data
Right 1203639106 Un_KI270750v1:141773-141795 TTAGAAAATAAGAGTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203639104 Original CRISPR CTAACATTTTTGCAGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr