ID: 1203639553

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270750v1:147542-147564
Sequence CTCAAAAATTAGTTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203639553_1203639556 -7 Left 1203639553 Un_KI270750v1:147542-147564 CCATGGCCCAACTAATTTTTGAG No data
Right 1203639556 Un_KI270750v1:147558-147580 TTTTGAGTTTTTACTAGAGATGG No data
1203639553_1203639558 -5 Left 1203639553 Un_KI270750v1:147542-147564 CCATGGCCCAACTAATTTTTGAG No data
Right 1203639558 Un_KI270750v1:147560-147582 TTGAGTTTTTACTAGAGATGGGG No data
1203639553_1203639559 14 Left 1203639553 Un_KI270750v1:147542-147564 CCATGGCCCAACTAATTTTTGAG No data
Right 1203639559 Un_KI270750v1:147579-147601 GGGGTTTCACCATGTTACCCAGG 0: 311
1: 24316
2: 137746
3: 206235
4: 199521
1203639553_1203639560 18 Left 1203639553 Un_KI270750v1:147542-147564 CCATGGCCCAACTAATTTTTGAG No data
Right 1203639560 Un_KI270750v1:147583-147605 TTTCACCATGTTACCCAGGATGG 0: 137
1: 21813
2: 87737
3: 177620
4: 203883
1203639553_1203639557 -6 Left 1203639553 Un_KI270750v1:147542-147564 CCATGGCCCAACTAATTTTTGAG No data
Right 1203639557 Un_KI270750v1:147559-147581 TTTGAGTTTTTACTAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203639553 Original CRISPR CTCAAAAATTAGTTGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr