ID: 1203655542

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270752v1:20732-20754
Sequence AAATTGCTAGAGATCTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203655537_1203655542 9 Left 1203655537 Un_KI270752v1:20700-20722 CCAGCTTCATTTTCTTTGTATAG No data
Right 1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG No data
1203655534_1203655542 19 Left 1203655534 Un_KI270752v1:20690-20712 CCACCAACGCCCAGCTTCATTTT No data
Right 1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG No data
1203655535_1203655542 16 Left 1203655535 Un_KI270752v1:20693-20715 CCAACGCCCAGCTTCATTTTCTT No data
Right 1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG No data
1203655536_1203655542 10 Left 1203655536 Un_KI270752v1:20699-20721 CCCAGCTTCATTTTCTTTGTATA No data
Right 1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203655542 Original CRISPR AAATTGCTAGAGATCTATGG GGG Intergenic
No off target data available for this crispr