ID: 1203657382

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:11337-11359
Sequence ATCAAGACGCAGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203657382_1203657387 -6 Left 1203657382 Un_KI270753v1:11337-11359 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 1203657387 Un_KI270753v1:11354-11376 CTTGATTTCCTCCAAGGTGGTGG No data
1203657382_1203657390 14 Left 1203657382 Un_KI270753v1:11337-11359 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 1203657390 Un_KI270753v1:11374-11396 TGGAGACCTCAGTCCTCCAGAGG No data
1203657382_1203657392 22 Left 1203657382 Un_KI270753v1:11337-11359 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 1203657392 Un_KI270753v1:11382-11404 TCAGTCCTCCAGAGGACACCTGG No data
1203657382_1203657386 -9 Left 1203657382 Un_KI270753v1:11337-11359 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 1203657386 Un_KI270753v1:11351-11373 CGTCTTGATTTCCTCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203657382 Original CRISPR ATCAAGACGCAGAGGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr