ID: 1203657587

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:13281-13303
Sequence TTCTGTGCATGGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203657587_1203657591 5 Left 1203657587 Un_KI270753v1:13281-13303 CCTTTTTCCCTCCATGCACAGAA No data
Right 1203657591 Un_KI270753v1:13309-13331 TCATAAAGAATAAGCATGAATGG No data
1203657587_1203657592 20 Left 1203657587 Un_KI270753v1:13281-13303 CCTTTTTCCCTCCATGCACAGAA No data
Right 1203657592 Un_KI270753v1:13324-13346 ATGAATGGAAACAACAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203657587 Original CRISPR TTCTGTGCATGGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr