ID: 1203658966

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:23742-23764
Sequence TCTGTCTTTGGAGTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203658966_1203658970 -8 Left 1203658966 Un_KI270753v1:23742-23764 CCAGCACCAACTCCAAAGACAGA No data
Right 1203658970 Un_KI270753v1:23757-23779 AAGACAGAGGTTCTGCTGCAAGG No data
1203658966_1203658973 20 Left 1203658966 Un_KI270753v1:23742-23764 CCAGCACCAACTCCAAAGACAGA No data
Right 1203658973 Un_KI270753v1:23785-23807 TGAGCCCGTGGCTGAACCCCAGG No data
1203658966_1203658972 8 Left 1203658966 Un_KI270753v1:23742-23764 CCAGCACCAACTCCAAAGACAGA No data
Right 1203658972 Un_KI270753v1:23773-23795 TGCAAGGACAGGTGAGCCCGTGG No data
1203658966_1203658976 30 Left 1203658966 Un_KI270753v1:23742-23764 CCAGCACCAACTCCAAAGACAGA No data
Right 1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG No data
1203658966_1203658971 -3 Left 1203658966 Un_KI270753v1:23742-23764 CCAGCACCAACTCCAAAGACAGA No data
Right 1203658971 Un_KI270753v1:23762-23784 AGAGGTTCTGCTGCAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203658966 Original CRISPR TCTGTCTTTGGAGTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr