ID: 1203658976

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:23795-23817
Sequence GCTGAACCCCAGGCAGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203658969_1203658976 18 Left 1203658969 Un_KI270753v1:23754-23776 CCAAAGACAGAGGTTCTGCTGCA No data
Right 1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG No data
1203658966_1203658976 30 Left 1203658966 Un_KI270753v1:23742-23764 CCAGCACCAACTCCAAAGACAGA No data
Right 1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG No data
1203658968_1203658976 24 Left 1203658968 Un_KI270753v1:23748-23770 CCAACTCCAAAGACAGAGGTTCT No data
Right 1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203658976 Original CRISPR GCTGAACCCCAGGCAGAAGC CGG Intergenic
No off target data available for this crispr