ID: 1203661016

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:42784-42806
Sequence AGCCGGCTGGGTTTCTGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203661008_1203661016 25 Left 1203661008 Un_KI270753v1:42736-42758 CCAGGCTAGGTGCCGCAAAGTCT No data
Right 1203661016 Un_KI270753v1:42784-42806 AGCCGGCTGGGTTTCTGTGTCGG No data
1203661013_1203661016 -9 Left 1203661013 Un_KI270753v1:42770-42792 CCATTGAGAGCTGAAGCCGGCTG No data
Right 1203661016 Un_KI270753v1:42784-42806 AGCCGGCTGGGTTTCTGTGTCGG No data
1203661011_1203661016 13 Left 1203661011 Un_KI270753v1:42748-42770 CCGCAAAGTCTCAGGGCAAGTGC No data
Right 1203661016 Un_KI270753v1:42784-42806 AGCCGGCTGGGTTTCTGTGTCGG No data
1203661007_1203661016 26 Left 1203661007 Un_KI270753v1:42735-42757 CCCAGGCTAGGTGCCGCAAAGTC No data
Right 1203661016 Un_KI270753v1:42784-42806 AGCCGGCTGGGTTTCTGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203661016 Original CRISPR AGCCGGCTGGGTTTCTGTGT CGG Intergenic
No off target data available for this crispr