ID: 1203661303

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:46085-46107
Sequence CTGTCAGCAGGGGCTGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203661292_1203661303 27 Left 1203661292 Un_KI270753v1:46035-46057 CCAGTTAATACTAACAGATCCTT No data
Right 1203661303 Un_KI270753v1:46085-46107 CTGTCAGCAGGGGCTGCTCTGGG No data
1203661298_1203661303 -9 Left 1203661298 Un_KI270753v1:46071-46093 CCGGAGCAGGCACGCTGTCAGCA No data
Right 1203661303 Un_KI270753v1:46085-46107 CTGTCAGCAGGGGCTGCTCTGGG No data
1203661296_1203661303 8 Left 1203661296 Un_KI270753v1:46054-46076 CCTTAGCTCGGGATTGTCCGGAG No data
Right 1203661303 Un_KI270753v1:46085-46107 CTGTCAGCAGGGGCTGCTCTGGG No data
1203661291_1203661303 28 Left 1203661291 Un_KI270753v1:46034-46056 CCCAGTTAATACTAACAGATCCT No data
Right 1203661303 Un_KI270753v1:46085-46107 CTGTCAGCAGGGGCTGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203661303 Original CRISPR CTGTCAGCAGGGGCTGCTCT GGG Intergenic