ID: 1203662621

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270753v1:59577-59599
Sequence CGGTGCTGCAGCTGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203662621_1203662625 -3 Left 1203662621 Un_KI270753v1:59577-59599 CCATCTCCTCAGCTGCAGCACCG No data
Right 1203662625 Un_KI270753v1:59597-59619 CCGGATGAAAGCTTCTTCCCCGG No data
1203662621_1203662629 22 Left 1203662621 Un_KI270753v1:59577-59599 CCATCTCCTCAGCTGCAGCACCG No data
Right 1203662629 Un_KI270753v1:59622-59644 ACACTCACCATCTCAGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203662621 Original CRISPR CGGTGCTGCAGCTGAGGAGA TGG (reversed) Intergenic
No off target data available for this crispr