ID: 1203670769

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270755v1:9252-9274
Sequence CGGTGCTGCAGCTGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203670765_1203670769 -3 Left 1203670765 Un_KI270755v1:9232-9254 CCAGGGAAGAAGCTTTCATCCGG No data
Right 1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG No data
1203670762_1203670769 22 Left 1203670762 Un_KI270755v1:9207-9229 CCAATCACTGAGATGGTGAGTGT No data
Right 1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203670769 Original CRISPR CGGTGCTGCAGCTGAGGAGA TGG Intergenic
No off target data available for this crispr