ID: 1203672103

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270755v1:25374-25396
Sequence GGAATAAATTTCCATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203672103_1203672107 3 Left 1203672103 Un_KI270755v1:25374-25396 CCTTTATAATGGAAATTTATTCC No data
Right 1203672107 Un_KI270755v1:25400-25422 CTTTTAAGCAGATAGAGGAAGGG No data
1203672103_1203672106 2 Left 1203672103 Un_KI270755v1:25374-25396 CCTTTATAATGGAAATTTATTCC No data
Right 1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG No data
1203672103_1203672105 -2 Left 1203672103 Un_KI270755v1:25374-25396 CCTTTATAATGGAAATTTATTCC No data
Right 1203672105 Un_KI270755v1:25395-25417 CCTTGCTTTTAAGCAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203672103 Original CRISPR GGAATAAATTTCCATTATAA AGG (reversed) Intergenic
No off target data available for this crispr