ID: 1203672106

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270755v1:25399-25421
Sequence GCTTTTAAGCAGATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203672103_1203672106 2 Left 1203672103 Un_KI270755v1:25374-25396 CCTTTATAATGGAAATTTATTCC No data
Right 1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203672106 Original CRISPR GCTTTTAAGCAGATAGAGGA AGG Intergenic
No off target data available for this crispr