ID: 1203697056

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:108936-108958
Sequence TGCCAGACCCTGCCCCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203697050_1203697056 -6 Left 1203697050 Un_GL000214v1:108919-108941 CCCCTGGCCTGAGAGCCTGCCAG No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data
1203697048_1203697056 11 Left 1203697048 Un_GL000214v1:108902-108924 CCTCTGGATCACAGGTGCCCCTG No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data
1203697051_1203697056 -7 Left 1203697051 Un_GL000214v1:108920-108942 CCCTGGCCTGAGAGCCTGCCAGA No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data
1203697052_1203697056 -8 Left 1203697052 Un_GL000214v1:108921-108943 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data
1203697047_1203697056 14 Left 1203697047 Un_GL000214v1:108899-108921 CCGCCTCTGGATCACAGGTGCCC No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data
1203697045_1203697056 20 Left 1203697045 Un_GL000214v1:108893-108915 CCTGGGCCGCCTCTGGATCACAG No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data
1203697044_1203697056 21 Left 1203697044 Un_GL000214v1:108892-108914 CCCTGGGCCGCCTCTGGATCACA No data
Right 1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203697056 Original CRISPR TGCCAGACCCTGCCCCGGCC CGG Intergenic
No off target data available for this crispr