ID: 1203697817

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:114176-114198
Sequence CAGTCCCTGCACTGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203697810_1203697817 3 Left 1203697810 Un_GL000214v1:114150-114172 CCCCACAGACGAAAGTGTCTTCC No data
Right 1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG No data
1203697809_1203697817 11 Left 1203697809 Un_GL000214v1:114142-114164 CCTGGGTGCCCCACAGACGAAAG No data
Right 1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG No data
1203697812_1203697817 1 Left 1203697812 Un_GL000214v1:114152-114174 CCACAGACGAAAGTGTCTTCCCA No data
Right 1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG No data
1203697811_1203697817 2 Left 1203697811 Un_GL000214v1:114151-114173 CCCACAGACGAAAGTGTCTTCCC No data
Right 1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203697817 Original CRISPR CAGTCCCTGCACTGGGACCC AGG Intergenic
No off target data available for this crispr