ID: 1203698471

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:117248-117270
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203698468_1203698471 7 Left 1203698468 Un_GL000214v1:117218-117240 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203698471 Un_GL000214v1:117248-117270 GTGTGACAGTAGCAAGTAGATGG No data
1203698470_1203698471 -5 Left 1203698470 Un_GL000214v1:117230-117252 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203698471 Un_GL000214v1:117248-117270 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203698471 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr