ID: 1203698817

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:119225-119247
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203698801_1203698817 29 Left 1203698801 Un_GL000214v1:119173-119195 CCACATCTCTGGTGAGGAGCTGC No data
Right 1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG No data
1203698807_1203698817 6 Left 1203698807 Un_GL000214v1:119196-119218 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG No data
1203698805_1203698817 7 Left 1203698805 Un_GL000214v1:119195-119217 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG No data
1203698808_1203698817 5 Left 1203698808 Un_GL000214v1:119197-119219 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203698817 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr