ID: 1203699247

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:122450-122472
Sequence GGGAAATCCTCGACAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699247_1203699253 -2 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699253 Un_GL000214v1:122471-122493 CCCAAAAAAACGCAGGATGTGGG No data
1203699247_1203699259 28 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data
1203699247_1203699251 -3 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699251 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
1203699247_1203699256 16 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699256 Un_GL000214v1:122489-122511 GTGGGATGCACCTAAGGCATAGG No data
1203699247_1203699249 -9 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699249 Un_GL000214v1:122464-122486 GGATTTCCCCAAAAAAACGCAGG No data
1203699247_1203699258 27 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699258 Un_GL000214v1:122500-122522 CTAAGGCATAGGAAAGAGAGAGG No data
1203699247_1203699255 10 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699255 Un_GL000214v1:122483-122505 CAGGATGTGGGATGCACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699247 Original CRISPR GGGAAATCCTCGACAGGTGC AGG (reversed) Intergenic
No off target data available for this crispr