ID: 1203699250

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:122470-122492
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699250_1203699255 -10 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699255 Un_GL000214v1:122483-122505 CAGGATGTGGGATGCACCTAAGG No data
1203699250_1203699256 -4 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699256 Un_GL000214v1:122489-122511 GTGGGATGCACCTAAGGCATAGG No data
1203699250_1203699259 8 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data
1203699250_1203699258 7 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699258 Un_GL000214v1:122500-122522 CTAAGGCATAGGAAAGAGAGAGG No data
1203699250_1203699260 15 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699260 Un_GL000214v1:122508-122530 TAGGAAAGAGAGAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699250 Original CRISPR CCACATCCTGCGTTTTTTTG GGG (reversed) Intergenic
No off target data available for this crispr