ID: 1203699255

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:122483-122505
Sequence CAGGATGTGGGATGCACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699248_1203699255 4 Left 1203699248 Un_GL000214v1:122456-122478 CCTGTCGAGGATTTCCCCAAAAA No data
Right 1203699255 Un_GL000214v1:122483-122505 CAGGATGTGGGATGCACCTAAGG No data
1203699247_1203699255 10 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699255 Un_GL000214v1:122483-122505 CAGGATGTGGGATGCACCTAAGG No data
1203699250_1203699255 -10 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699255 Un_GL000214v1:122483-122505 CAGGATGTGGGATGCACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699255 Original CRISPR CAGGATGTGGGATGCACCTA AGG Intergenic
No off target data available for this crispr