ID: 1203699259

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:122501-122523
Sequence TAAGGCATAGGAAAGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699250_1203699259 8 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data
1203699248_1203699259 22 Left 1203699248 Un_GL000214v1:122456-122478 CCTGTCGAGGATTTCCCCAAAAA No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data
1203699247_1203699259 28 Left 1203699247 Un_GL000214v1:122450-122472 CCTGCACCTGTCGAGGATTTCCC No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data
1203699252_1203699259 7 Left 1203699252 Un_GL000214v1:122471-122493 CCCAAAAAAACGCAGGATGTGGG No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data
1203699254_1203699259 6 Left 1203699254 Un_GL000214v1:122472-122494 CCAAAAAAACGCAGGATGTGGGA No data
Right 1203699259 Un_GL000214v1:122501-122523 TAAGGCATAGGAAAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699259 Original CRISPR TAAGGCATAGGAAAGAGAGA GGG Intergenic
No off target data available for this crispr