ID: 1203699260

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:122508-122530
Sequence TAGGAAAGAGAGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699252_1203699260 14 Left 1203699252 Un_GL000214v1:122471-122493 CCCAAAAAAACGCAGGATGTGGG No data
Right 1203699260 Un_GL000214v1:122508-122530 TAGGAAAGAGAGAGGGCAGAAGG No data
1203699254_1203699260 13 Left 1203699254 Un_GL000214v1:122472-122494 CCAAAAAAACGCAGGATGTGGGA No data
Right 1203699260 Un_GL000214v1:122508-122530 TAGGAAAGAGAGAGGGCAGAAGG No data
1203699250_1203699260 15 Left 1203699250 Un_GL000214v1:122470-122492 CCCCAAAAAAACGCAGGATGTGG No data
Right 1203699260 Un_GL000214v1:122508-122530 TAGGAAAGAGAGAGGGCAGAAGG No data
1203699248_1203699260 29 Left 1203699248 Un_GL000214v1:122456-122478 CCTGTCGAGGATTTCCCCAAAAA No data
Right 1203699260 Un_GL000214v1:122508-122530 TAGGAAAGAGAGAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699260 Original CRISPR TAGGAAAGAGAGAGGGCAGA AGG Intergenic
No off target data available for this crispr