ID: 1203699389

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:123399-123421
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699386_1203699389 7 Left 1203699386 Un_GL000214v1:123369-123391 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203699389 Un_GL000214v1:123399-123421 GTGTGACAGTAGCAAGTAGATGG No data
1203699388_1203699389 -5 Left 1203699388 Un_GL000214v1:123381-123403 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203699389 Un_GL000214v1:123399-123421 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699389 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr