ID: 1203699773

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:125523-125545
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203699761_1203699773 7 Left 1203699761 Un_GL000214v1:125493-125515 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG No data
1203699763_1203699773 6 Left 1203699763 Un_GL000214v1:125494-125516 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG No data
1203699755_1203699773 29 Left 1203699755 Un_GL000214v1:125471-125493 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG No data
1203699764_1203699773 5 Left 1203699764 Un_GL000214v1:125495-125517 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG No data
1203699756_1203699773 23 Left 1203699756 Un_GL000214v1:125477-125499 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG No data
1203699757_1203699773 22 Left 1203699757 Un_GL000214v1:125478-125500 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203699773 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr