ID: 1203700333

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:129682-129704
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203700332_1203700333 -5 Left 1203700332 Un_GL000214v1:129664-129686 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203700333 Un_GL000214v1:129682-129704 GTGTGACAGTAGCAAGTAGATGG No data
1203700330_1203700333 7 Left 1203700330 Un_GL000214v1:129652-129674 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203700333 Un_GL000214v1:129682-129704 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203700333 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr