ID: 1203700895

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:132815-132837
Sequence GACTGTGGCAAGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203700895_1203700900 3 Left 1203700895 Un_GL000214v1:132815-132837 CCAGCAGCATCCTTGCCACAGTC No data
Right 1203700900 Un_GL000214v1:132841-132863 CGCCGGAGATCCGCAGATCTGGG No data
1203700895_1203700899 2 Left 1203700895 Un_GL000214v1:132815-132837 CCAGCAGCATCCTTGCCACAGTC No data
Right 1203700899 Un_GL000214v1:132840-132862 ACGCCGGAGATCCGCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203700895 Original CRISPR GACTGTGGCAAGGATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr