ID: 1203701255

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000214v1:135702-135724
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203701254_1203701255 -5 Left 1203701254 Un_GL000214v1:135684-135706 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203701255 Un_GL000214v1:135702-135724 GTGTGACAGTAGCAAGTAGATGG No data
1203701252_1203701255 7 Left 1203701252 Un_GL000214v1:135672-135694 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203701255 Un_GL000214v1:135702-135724 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203701255 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr