ID: 1203702241

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270742v1:6274-6296
Sequence GTGTACACCCACTGCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203702236_1203702241 11 Left 1203702236 Un_KI270742v1:6240-6262 CCACATGGATATTGGGAACAATA No data
Right 1203702241 Un_KI270742v1:6274-6296 GTGTACACCCACTGCGATATTGG No data
1203702235_1203702241 16 Left 1203702235 Un_KI270742v1:6235-6257 CCTTTCCACATGGATATTGGGAA No data
Right 1203702241 Un_KI270742v1:6274-6296 GTGTACACCCACTGCGATATTGG No data
1203702234_1203702241 17 Left 1203702234 Un_KI270742v1:6234-6256 CCCTTTCCACATGGATATTGGGA No data
Right 1203702241 Un_KI270742v1:6274-6296 GTGTACACCCACTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203702241 Original CRISPR GTGTACACCCACTGCGATAT TGG Intergenic
No off target data available for this crispr