ID: 1203707868

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270742v1:69018-69040
Sequence GTGTTGTCACGGAGGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203707868_1203707876 8 Left 1203707868 Un_KI270742v1:69018-69040 CCTGATCACCTCCGTGACAACAC No data
Right 1203707876 Un_KI270742v1:69049-69071 CCCATCAGGGCCCTGTCACCAGG No data
1203707868_1203707872 -6 Left 1203707868 Un_KI270742v1:69018-69040 CCTGATCACCTCCGTGACAACAC No data
Right 1203707872 Un_KI270742v1:69035-69057 CAACACAGGACAACCCCATCAGG No data
1203707868_1203707873 -5 Left 1203707868 Un_KI270742v1:69018-69040 CCTGATCACCTCCGTGACAACAC No data
Right 1203707873 Un_KI270742v1:69036-69058 AACACAGGACAACCCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203707868 Original CRISPR GTGTTGTCACGGAGGTGATC AGG (reversed) Intergenic
No off target data available for this crispr