ID: 1203711644

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270742v1:103705-103727
Sequence TTGAGTAAGTACAGTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203711644_1203711645 22 Left 1203711644 Un_KI270742v1:103705-103727 CCTGGTGTACTGTACTTACTCAA No data
Right 1203711645 Un_KI270742v1:103750-103772 GCCATCTCTAAAATGTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203711644 Original CRISPR TTGAGTAAGTACAGTACACC AGG (reversed) Intergenic
No off target data available for this crispr