ID: 1203719613

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:3756-3778
Sequence TGGAATAGAAGCAACACGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203719613_1203719621 27 Left 1203719613 Un_GL000216v2:3756-3778 CCACTCGTGTTGCTTCTATTCCA No data
Right 1203719621 Un_GL000216v2:3806-3828 CCATTCCATTACTTTCCACTCGG No data
1203719613_1203719622 28 Left 1203719613 Un_GL000216v2:3756-3778 CCACTCGTGTTGCTTCTATTCCA No data
Right 1203719622 Un_GL000216v2:3807-3829 CATTCCATTACTTTCCACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203719613 Original CRISPR TGGAATAGAAGCAACACGAG TGG (reversed) Intergenic
No off target data available for this crispr